vegf receptor (vegfr2) (kdr) Search Results


92
OriGene myc ddk flag tagged vegfr2
(A) Representative confocal images showing expression of <t>VEGFR2</t> (green) in Bev-sensitive RF24-par and Bev-resistant RF24-Bev cells treated with VEGF only or VEGF + Bev. Scale bar, 50 μm; n = 3. (B) Expression of VEGFR2 pY1175 and pY1214 and total VEGFR2 in subcellular fractions of HPAECs. Only under VEGF-A (10 ng/mL) + Bev (5 μg/μL) treatment did the ~100-kD fragment of VEGFR2 appear together with the phosphorylated and total matured VEGFR2 (~220 kD). We used lamin A/C (LMNC) as a marker for the nuclear fraction (NER) and β-actin as a marker for whole-cell lysate (WCL) and cytoplasmic (Cyto) fractions. (C and D) Expression of Cyto p130cas and its 31-kDa nuclear fragment was observed in subcellular fractions from RF24-par cells but not from RF24-Bev cells (C). We used lamin B1 (LMNB1) as a marker for NER and β-actin as a marker for Cyto. When treated with VEGF + Bev, the 100-kDa nuclear fragment of VEGFR2 was observed only in subcellular fractions of RF24-par cells but not of RF24-Bev cells (D). Activated/cleaved caspase-10 was also observed in the Cyto and NER fractions of RF24-par cells treated with VEGF + Bev. (E and F) Representative confocal images showing co-localization of LC3B (green) and VEGFR2 (red) in RF24-par (E) or caspase-10-depleted RF24 casp10 — / — (F) cells in response to treatment with CTL, VEGF only, or VEGF + Bev. Scale bar, 50 μm; n = 3. (G) Top: co-immunoprecipitation of p130cas and LC3B or VEGFR2 in RF24-par cells treated with CTL, VEGF, or VEGF + Bev. Bottom: reciprocal immunoprecipitates of VEGFR2 and LC3B or p130cas. (H) Representative confocal images showing co-localization of LC3B and VEGFR2 or p130cas in RF24-par cells treated with CTL, VEGF only, or VEGF + Bev. Scale bar, 50 μm; n = 3. (I) Representative transmission electron microscopy images of mouse ovarian ECs (MOECs). In comparison with VEGF treatment, in which nuclei (NUs), rough endoplasmic reticulum (RER), and regular mitochondria (Ms) were visible, VEGF + B20 (murine AVA) treatment induced numerous autophagosomes (APs), lysosomes (Ly), and autolysosomes (Aly); abundant phagophores (Ph) were identified in Aly membranes. The substructure was observed under 5,000× and 50,000× magnification (n = 5).
Myc Ddk Flag Tagged Vegfr2, supplied by OriGene, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/vegf+receptor+(vegfr2)+(kdr)/VEGF+Receptor+2+(KDR)+(NM_002253)+Human+Tagged+ORF+Clone/pmc08860355-304-0-5
Average 92 stars, based on 1 article reviews
myc ddk flag tagged vegfr2 - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier

92
OriGene origene vegfr2 ggcgaatcactcacaccagt gcaattctgtcacccagggat
(A) Representative confocal images showing expression of <t>VEGFR2</t> (green) in Bev-sensitive RF24-par and Bev-resistant RF24-Bev cells treated with VEGF only or VEGF + Bev. Scale bar, 50 μm; n = 3. (B) Expression of VEGFR2 pY1175 and pY1214 and total VEGFR2 in subcellular fractions of HPAECs. Only under VEGF-A (10 ng/mL) + Bev (5 μg/μL) treatment did the ~100-kD fragment of VEGFR2 appear together with the phosphorylated and total matured VEGFR2 (~220 kD). We used lamin A/C (LMNC) as a marker for the nuclear fraction (NER) and β-actin as a marker for whole-cell lysate (WCL) and cytoplasmic (Cyto) fractions. (C and D) Expression of Cyto p130cas and its 31-kDa nuclear fragment was observed in subcellular fractions from RF24-par cells but not from RF24-Bev cells (C). We used lamin B1 (LMNB1) as a marker for NER and β-actin as a marker for Cyto. When treated with VEGF + Bev, the 100-kDa nuclear fragment of VEGFR2 was observed only in subcellular fractions of RF24-par cells but not of RF24-Bev cells (D). Activated/cleaved caspase-10 was also observed in the Cyto and NER fractions of RF24-par cells treated with VEGF + Bev. (E and F) Representative confocal images showing co-localization of LC3B (green) and VEGFR2 (red) in RF24-par (E) or caspase-10-depleted RF24 casp10 — / — (F) cells in response to treatment with CTL, VEGF only, or VEGF + Bev. Scale bar, 50 μm; n = 3. (G) Top: co-immunoprecipitation of p130cas and LC3B or VEGFR2 in RF24-par cells treated with CTL, VEGF, or VEGF + Bev. Bottom: reciprocal immunoprecipitates of VEGFR2 and LC3B or p130cas. (H) Representative confocal images showing co-localization of LC3B and VEGFR2 or p130cas in RF24-par cells treated with CTL, VEGF only, or VEGF + Bev. Scale bar, 50 μm; n = 3. (I) Representative transmission electron microscopy images of mouse ovarian ECs (MOECs). In comparison with VEGF treatment, in which nuclei (NUs), rough endoplasmic reticulum (RER), and regular mitochondria (Ms) were visible, VEGF + B20 (murine AVA) treatment induced numerous autophagosomes (APs), lysosomes (Ly), and autolysosomes (Aly); abundant phagophores (Ph) were identified in Aly membranes. The substructure was observed under 5,000× and 50,000× magnification (n = 5).
Origene Vegfr2 Ggcgaatcactcacaccagt Gcaattctgtcacccagggat, supplied by OriGene, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/vegf+receptor+(vegfr2)+(kdr)/VEGF+Receptor+2+(KDR)+(NM_002253)+Human+Tagged+ORF+Clone/ppr0901095-100-69-69
Average 92 stars, based on 1 article reviews
origene vegfr2 ggcgaatcactcacaccagt gcaattctgtcacccagggat - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier

90
OriGene length vegfr
(A) Representative confocal images showing expression of <t>VEGFR2</t> (green) in Bev-sensitive RF24-par and Bev-resistant RF24-Bev cells treated with VEGF only or VEGF + Bev. Scale bar, 50 μm; n = 3. (B) Expression of VEGFR2 pY1175 and pY1214 and total VEGFR2 in subcellular fractions of HPAECs. Only under VEGF-A (10 ng/mL) + Bev (5 μg/μL) treatment did the ~100-kD fragment of VEGFR2 appear together with the phosphorylated and total matured VEGFR2 (~220 kD). We used lamin A/C (LMNC) as a marker for the nuclear fraction (NER) and β-actin as a marker for whole-cell lysate (WCL) and cytoplasmic (Cyto) fractions. (C and D) Expression of Cyto p130cas and its 31-kDa nuclear fragment was observed in subcellular fractions from RF24-par cells but not from RF24-Bev cells (C). We used lamin B1 (LMNB1) as a marker for NER and β-actin as a marker for Cyto. When treated with VEGF + Bev, the 100-kDa nuclear fragment of VEGFR2 was observed only in subcellular fractions of RF24-par cells but not of RF24-Bev cells (D). Activated/cleaved caspase-10 was also observed in the Cyto and NER fractions of RF24-par cells treated with VEGF + Bev. (E and F) Representative confocal images showing co-localization of LC3B (green) and VEGFR2 (red) in RF24-par (E) or caspase-10-depleted RF24 casp10 — / — (F) cells in response to treatment with CTL, VEGF only, or VEGF + Bev. Scale bar, 50 μm; n = 3. (G) Top: co-immunoprecipitation of p130cas and LC3B or VEGFR2 in RF24-par cells treated with CTL, VEGF, or VEGF + Bev. Bottom: reciprocal immunoprecipitates of VEGFR2 and LC3B or p130cas. (H) Representative confocal images showing co-localization of LC3B and VEGFR2 or p130cas in RF24-par cells treated with CTL, VEGF only, or VEGF + Bev. Scale bar, 50 μm; n = 3. (I) Representative transmission electron microscopy images of mouse ovarian ECs (MOECs). In comparison with VEGF treatment, in which nuclei (NUs), rough endoplasmic reticulum (RER), and regular mitochondria (Ms) were visible, VEGF + B20 (murine AVA) treatment induced numerous autophagosomes (APs), lysosomes (Ly), and autolysosomes (Aly); abundant phagophores (Ph) were identified in Aly membranes. The substructure was observed under 5,000× and 50,000× magnification (n = 5).
Length Vegfr, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/vegf+receptor+(vegfr2)+(kdr)/VEGF+Receptor+2+(KDR)+(NM_002253)+Human+Untagged+Clone/pmc03205910-48-4-9
Average 90 stars, based on 1 article reviews
length vegfr - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
OriGene full length human kdr
(A) Representative confocal images showing expression of <t>VEGFR2</t> (green) in Bev-sensitive RF24-par and Bev-resistant RF24-Bev cells treated with VEGF only or VEGF + Bev. Scale bar, 50 μm; n = 3. (B) Expression of VEGFR2 pY1175 and pY1214 and total VEGFR2 in subcellular fractions of HPAECs. Only under VEGF-A (10 ng/mL) + Bev (5 μg/μL) treatment did the ~100-kD fragment of VEGFR2 appear together with the phosphorylated and total matured VEGFR2 (~220 kD). We used lamin A/C (LMNC) as a marker for the nuclear fraction (NER) and β-actin as a marker for whole-cell lysate (WCL) and cytoplasmic (Cyto) fractions. (C and D) Expression of Cyto p130cas and its 31-kDa nuclear fragment was observed in subcellular fractions from RF24-par cells but not from RF24-Bev cells (C). We used lamin B1 (LMNB1) as a marker for NER and β-actin as a marker for Cyto. When treated with VEGF + Bev, the 100-kDa nuclear fragment of VEGFR2 was observed only in subcellular fractions of RF24-par cells but not of RF24-Bev cells (D). Activated/cleaved caspase-10 was also observed in the Cyto and NER fractions of RF24-par cells treated with VEGF + Bev. (E and F) Representative confocal images showing co-localization of LC3B (green) and VEGFR2 (red) in RF24-par (E) or caspase-10-depleted RF24 casp10 — / — (F) cells in response to treatment with CTL, VEGF only, or VEGF + Bev. Scale bar, 50 μm; n = 3. (G) Top: co-immunoprecipitation of p130cas and LC3B or VEGFR2 in RF24-par cells treated with CTL, VEGF, or VEGF + Bev. Bottom: reciprocal immunoprecipitates of VEGFR2 and LC3B or p130cas. (H) Representative confocal images showing co-localization of LC3B and VEGFR2 or p130cas in RF24-par cells treated with CTL, VEGF only, or VEGF + Bev. Scale bar, 50 μm; n = 3. (I) Representative transmission electron microscopy images of mouse ovarian ECs (MOECs). In comparison with VEGF treatment, in which nuclei (NUs), rough endoplasmic reticulum (RER), and regular mitochondria (Ms) were visible, VEGF + B20 (murine AVA) treatment induced numerous autophagosomes (APs), lysosomes (Ly), and autolysosomes (Aly); abundant phagophores (Ph) were identified in Aly membranes. The substructure was observed under 5,000× and 50,000× magnification (n = 5).
Full Length Human Kdr, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/vegf+receptor+(vegfr2)+(kdr)/VEGF+Receptor+2+(KDR)+(NM_002253)+Human+Tagged+ORF+Clone/us09862758-978-33-36
Average 90 stars, based on 1 article reviews
full length human kdr - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
OriGene length human vegfr2
Panel A: HEK293 cells transfected with <t>VEGFR2</t> and conditioned media immunoblotted for sFlt1. VEGFR2 expression dose dependently increases sFlt1 expression. Panel B: HEK293 cells transfected with VEGFR2 and VEGF in conditioned media measured by ELISA. VEGFR2 dose dependently reduces free VEGF in conditioned media. **p<0.001 against vehicle, $ p<0.05 between low and high VEGFR2 expressed groups, n = 4. Panel C: HEK293 cells co-transfected with epitope tagged Flt1 ΔCTD and VEGFR2 and Flt1 ΔCTD (Flag epitope) and its N-term fragment (HA epitope) measured in cell lysates and conditioned media respectively. Cell lysates were also immunoblotted for VEGFR2 to confirm overexpression and for tubulin as a control for loading. VEGFR2 dose dependently reduces cleavage of Flt1 manifest by increased abundance of uncleaved Flt1 in cell lysates and reduced abundance of the cleaved N-terminal fragment in conditioned media (condt. Media). Panel D: HEK293 cells co-transfected with epitope tagged Flt1 ΔCTD and VEGFR2 or control plasmid and treated with 30 nM PMA in the presence and absence of 10 U/ml heparin overnight. Conditioned media (Condt. Media) was immunoblotted for the N-terminal fragment while cell lysates were immunoprecipitated with Flag and then blotted for VEGFR2 (Flk1). VEGFR2 significantly reduces the availability of the cleaved Flt1 fragment in conditioned media while heparin has a modest effect. VEGFR2 and Flt1 physically associate and heparin does not alter this association.
Length Human Vegfr2, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/vegf+receptor+(vegfr2)+(kdr)/VEGF+Receptor+2+(KDR)+(NM_002253)+Human+Tagged+ORF+Clone/pmc04227870-31-9-15
Average 90 stars, based on 1 article reviews
length human vegfr2 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

93
MedChemExpress anti vegfr2
Panel A: HEK293 cells transfected with <t>VEGFR2</t> and conditioned media immunoblotted for sFlt1. VEGFR2 expression dose dependently increases sFlt1 expression. Panel B: HEK293 cells transfected with VEGFR2 and VEGF in conditioned media measured by ELISA. VEGFR2 dose dependently reduces free VEGF in conditioned media. **p<0.001 against vehicle, $ p<0.05 between low and high VEGFR2 expressed groups, n = 4. Panel C: HEK293 cells co-transfected with epitope tagged Flt1 ΔCTD and VEGFR2 and Flt1 ΔCTD (Flag epitope) and its N-term fragment (HA epitope) measured in cell lysates and conditioned media respectively. Cell lysates were also immunoblotted for VEGFR2 to confirm overexpression and for tubulin as a control for loading. VEGFR2 dose dependently reduces cleavage of Flt1 manifest by increased abundance of uncleaved Flt1 in cell lysates and reduced abundance of the cleaved N-terminal fragment in conditioned media (condt. Media). Panel D: HEK293 cells co-transfected with epitope tagged Flt1 ΔCTD and VEGFR2 or control plasmid and treated with 30 nM PMA in the presence and absence of 10 U/ml heparin overnight. Conditioned media (Condt. Media) was immunoblotted for the N-terminal fragment while cell lysates were immunoprecipitated with Flag and then blotted for VEGFR2 (Flk1). VEGFR2 significantly reduces the availability of the cleaved Flt1 fragment in conditioned media while heparin has a modest effect. VEGFR2 and Flt1 physically associate and heparin does not alter this association.
Anti Vegfr2, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/vegf+receptor+(vegfr2)+(kdr)/VEGF+Receptor+2+Antibody/pmc11600141-54-9-10
Average 93 stars, based on 1 article reviews
anti vegfr2 - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

94
Boster Bio vegfr2
Panel A: HEK293 cells transfected with <t>VEGFR2</t> and conditioned media immunoblotted for sFlt1. VEGFR2 expression dose dependently increases sFlt1 expression. Panel B: HEK293 cells transfected with VEGFR2 and VEGF in conditioned media measured by ELISA. VEGFR2 dose dependently reduces free VEGF in conditioned media. **p<0.001 against vehicle, $ p<0.05 between low and high VEGFR2 expressed groups, n = 4. Panel C: HEK293 cells co-transfected with epitope tagged Flt1 ΔCTD and VEGFR2 and Flt1 ΔCTD (Flag epitope) and its N-term fragment (HA epitope) measured in cell lysates and conditioned media respectively. Cell lysates were also immunoblotted for VEGFR2 to confirm overexpression and for tubulin as a control for loading. VEGFR2 dose dependently reduces cleavage of Flt1 manifest by increased abundance of uncleaved Flt1 in cell lysates and reduced abundance of the cleaved N-terminal fragment in conditioned media (condt. Media). Panel D: HEK293 cells co-transfected with epitope tagged Flt1 ΔCTD and VEGFR2 or control plasmid and treated with 30 nM PMA in the presence and absence of 10 U/ml heparin overnight. Conditioned media (Condt. Media) was immunoblotted for the N-terminal fragment while cell lysates were immunoprecipitated with Flag and then blotted for VEGFR2 (Flk1). VEGFR2 significantly reduces the availability of the cleaved Flt1 fragment in conditioned media while heparin has a modest effect. VEGFR2 and Flt1 physically associate and heparin does not alter this association.
Vegfr2, supplied by Boster Bio, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/vegf+receptor+(vegfr2)+(kdr)/Human+VEGF+R2%2FKDR%2FFlk-1+Recombinant+Protein/pm27163719-66-16-24
Average 94 stars, based on 1 article reviews
vegfr2 - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

92
Boster Bio c kit vegfr
Panel A: HEK293 cells transfected with <t>VEGFR2</t> and conditioned media immunoblotted for sFlt1. VEGFR2 expression dose dependently increases sFlt1 expression. Panel B: HEK293 cells transfected with VEGFR2 and VEGF in conditioned media measured by ELISA. VEGFR2 dose dependently reduces free VEGF in conditioned media. **p<0.001 against vehicle, $ p<0.05 between low and high VEGFR2 expressed groups, n = 4. Panel C: HEK293 cells co-transfected with epitope tagged Flt1 ΔCTD and VEGFR2 and Flt1 ΔCTD (Flag epitope) and its N-term fragment (HA epitope) measured in cell lysates and conditioned media respectively. Cell lysates were also immunoblotted for VEGFR2 to confirm overexpression and for tubulin as a control for loading. VEGFR2 dose dependently reduces cleavage of Flt1 manifest by increased abundance of uncleaved Flt1 in cell lysates and reduced abundance of the cleaved N-terminal fragment in conditioned media (condt. Media). Panel D: HEK293 cells co-transfected with epitope tagged Flt1 ΔCTD and VEGFR2 or control plasmid and treated with 30 nM PMA in the presence and absence of 10 U/ml heparin overnight. Conditioned media (Condt. Media) was immunoblotted for the N-terminal fragment while cell lysates were immunoprecipitated with Flag and then blotted for VEGFR2 (Flk1). VEGFR2 significantly reduces the availability of the cleaved Flt1 fragment in conditioned media while heparin has a modest effect. VEGFR2 and Flt1 physically associate and heparin does not alter this association.
C Kit Vegfr, supplied by Boster Bio, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/vegf+receptor+(vegfr2)+(kdr)/Human+VEGFR2+%2F+KDR+%2F+VEGF+Receptor+2+ELISA+Kit+PicoKine/pm35962935-146-8-47
Average 92 stars, based on 1 article reviews
c kit vegfr - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier

90
Informa UK Limited vegf receptor-2 (vegfr-2, kdr/flk-1)
Panel A: HEK293 cells transfected with <t>VEGFR2</t> and conditioned media immunoblotted for sFlt1. VEGFR2 expression dose dependently increases sFlt1 expression. Panel B: HEK293 cells transfected with VEGFR2 and VEGF in conditioned media measured by ELISA. VEGFR2 dose dependently reduces free VEGF in conditioned media. **p<0.001 against vehicle, $ p<0.05 between low and high VEGFR2 expressed groups, n = 4. Panel C: HEK293 cells co-transfected with epitope tagged Flt1 ΔCTD and VEGFR2 and Flt1 ΔCTD (Flag epitope) and its N-term fragment (HA epitope) measured in cell lysates and conditioned media respectively. Cell lysates were also immunoblotted for VEGFR2 to confirm overexpression and for tubulin as a control for loading. VEGFR2 dose dependently reduces cleavage of Flt1 manifest by increased abundance of uncleaved Flt1 in cell lysates and reduced abundance of the cleaved N-terminal fragment in conditioned media (condt. Media). Panel D: HEK293 cells co-transfected with epitope tagged Flt1 ΔCTD and VEGFR2 or control plasmid and treated with 30 nM PMA in the presence and absence of 10 U/ml heparin overnight. Conditioned media (Condt. Media) was immunoblotted for the N-terminal fragment while cell lysates were immunoprecipitated with Flag and then blotted for VEGFR2 (Flk1). VEGFR2 significantly reduces the availability of the cleaved Flt1 fragment in conditioned media while heparin has a modest effect. VEGFR2 and Flt1 physically associate and heparin does not alter this association.
Vegf Receptor 2 (Vegfr 2, Kdr/Flk 1), supplied by Informa UK Limited, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/vegf+receptor+(vegfr2)+(kdr)/vegf+receptor+2++vegfr+2++kdr+flk+1+/pm28720001-30-9-51
Average 90 stars, based on 1 article reviews
vegf receptor-2 (vegfr-2, kdr/flk-1) - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

99
NSJ Bioreagents vegf receptor 2 antibody / vegfr2 / kdr
Panel A: HEK293 cells transfected with <t>VEGFR2</t> and conditioned media immunoblotted for sFlt1. VEGFR2 expression dose dependently increases sFlt1 expression. Panel B: HEK293 cells transfected with VEGFR2 and VEGF in conditioned media measured by ELISA. VEGFR2 dose dependently reduces free VEGF in conditioned media. **p<0.001 against vehicle, $ p<0.05 between low and high VEGFR2 expressed groups, n = 4. Panel C: HEK293 cells co-transfected with epitope tagged Flt1 ΔCTD and VEGFR2 and Flt1 ΔCTD (Flag epitope) and its N-term fragment (HA epitope) measured in cell lysates and conditioned media respectively. Cell lysates were also immunoblotted for VEGFR2 to confirm overexpression and for tubulin as a control for loading. VEGFR2 dose dependently reduces cleavage of Flt1 manifest by increased abundance of uncleaved Flt1 in cell lysates and reduced abundance of the cleaved N-terminal fragment in conditioned media (condt. Media). Panel D: HEK293 cells co-transfected with epitope tagged Flt1 ΔCTD and VEGFR2 or control plasmid and treated with 30 nM PMA in the presence and absence of 10 U/ml heparin overnight. Conditioned media (Condt. Media) was immunoblotted for the N-terminal fragment while cell lysates were immunoprecipitated with Flag and then blotted for VEGFR2 (Flk1). VEGFR2 significantly reduces the availability of the cleaved Flt1 fragment in conditioned media while heparin has a modest effect. VEGFR2 and Flt1 physically associate and heparin does not alter this association.
Vegf Receptor 2 Antibody / Vegfr2 / Kdr, supplied by NSJ Bioreagents, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/vegf+receptor+(vegfr2)+(kdr)/VEGF+Receptor+2+Antibody+%2F+VEGFR2+%2F+KDR/custom%40v8272%4010%2E1101%2F2025%2E09%2E16%2E676456
Average 99 stars, based on 1 article reviews
vegf receptor 2 antibody / vegfr2 / kdr - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

Image Search Results


(A) Representative confocal images showing expression of VEGFR2 (green) in Bev-sensitive RF24-par and Bev-resistant RF24-Bev cells treated with VEGF only or VEGF + Bev. Scale bar, 50 μm; n = 3. (B) Expression of VEGFR2 pY1175 and pY1214 and total VEGFR2 in subcellular fractions of HPAECs. Only under VEGF-A (10 ng/mL) + Bev (5 μg/μL) treatment did the ~100-kD fragment of VEGFR2 appear together with the phosphorylated and total matured VEGFR2 (~220 kD). We used lamin A/C (LMNC) as a marker for the nuclear fraction (NER) and β-actin as a marker for whole-cell lysate (WCL) and cytoplasmic (Cyto) fractions. (C and D) Expression of Cyto p130cas and its 31-kDa nuclear fragment was observed in subcellular fractions from RF24-par cells but not from RF24-Bev cells (C). We used lamin B1 (LMNB1) as a marker for NER and β-actin as a marker for Cyto. When treated with VEGF + Bev, the 100-kDa nuclear fragment of VEGFR2 was observed only in subcellular fractions of RF24-par cells but not of RF24-Bev cells (D). Activated/cleaved caspase-10 was also observed in the Cyto and NER fractions of RF24-par cells treated with VEGF + Bev. (E and F) Representative confocal images showing co-localization of LC3B (green) and VEGFR2 (red) in RF24-par (E) or caspase-10-depleted RF24 casp10 — / — (F) cells in response to treatment with CTL, VEGF only, or VEGF + Bev. Scale bar, 50 μm; n = 3. (G) Top: co-immunoprecipitation of p130cas and LC3B or VEGFR2 in RF24-par cells treated with CTL, VEGF, or VEGF + Bev. Bottom: reciprocal immunoprecipitates of VEGFR2 and LC3B or p130cas. (H) Representative confocal images showing co-localization of LC3B and VEGFR2 or p130cas in RF24-par cells treated with CTL, VEGF only, or VEGF + Bev. Scale bar, 50 μm; n = 3. (I) Representative transmission electron microscopy images of mouse ovarian ECs (MOECs). In comparison with VEGF treatment, in which nuclei (NUs), rough endoplasmic reticulum (RER), and regular mitochondria (Ms) were visible, VEGF + B20 (murine AVA) treatment induced numerous autophagosomes (APs), lysosomes (Ly), and autolysosomes (Aly); abundant phagophores (Ph) were identified in Aly membranes. The substructure was observed under 5,000× and 50,000× magnification (n = 5).

Journal: Cell reports

Article Title: Endothelial p130cas confers resistance to anti-angiogenesis therapy

doi: 10.1016/j.celrep.2022.110301

Figure Lengend Snippet: (A) Representative confocal images showing expression of VEGFR2 (green) in Bev-sensitive RF24-par and Bev-resistant RF24-Bev cells treated with VEGF only or VEGF + Bev. Scale bar, 50 μm; n = 3. (B) Expression of VEGFR2 pY1175 and pY1214 and total VEGFR2 in subcellular fractions of HPAECs. Only under VEGF-A (10 ng/mL) + Bev (5 μg/μL) treatment did the ~100-kD fragment of VEGFR2 appear together with the phosphorylated and total matured VEGFR2 (~220 kD). We used lamin A/C (LMNC) as a marker for the nuclear fraction (NER) and β-actin as a marker for whole-cell lysate (WCL) and cytoplasmic (Cyto) fractions. (C and D) Expression of Cyto p130cas and its 31-kDa nuclear fragment was observed in subcellular fractions from RF24-par cells but not from RF24-Bev cells (C). We used lamin B1 (LMNB1) as a marker for NER and β-actin as a marker for Cyto. When treated with VEGF + Bev, the 100-kDa nuclear fragment of VEGFR2 was observed only in subcellular fractions of RF24-par cells but not of RF24-Bev cells (D). Activated/cleaved caspase-10 was also observed in the Cyto and NER fractions of RF24-par cells treated with VEGF + Bev. (E and F) Representative confocal images showing co-localization of LC3B (green) and VEGFR2 (red) in RF24-par (E) or caspase-10-depleted RF24 casp10 — / — (F) cells in response to treatment with CTL, VEGF only, or VEGF + Bev. Scale bar, 50 μm; n = 3. (G) Top: co-immunoprecipitation of p130cas and LC3B or VEGFR2 in RF24-par cells treated with CTL, VEGF, or VEGF + Bev. Bottom: reciprocal immunoprecipitates of VEGFR2 and LC3B or p130cas. (H) Representative confocal images showing co-localization of LC3B and VEGFR2 or p130cas in RF24-par cells treated with CTL, VEGF only, or VEGF + Bev. Scale bar, 50 μm; n = 3. (I) Representative transmission electron microscopy images of mouse ovarian ECs (MOECs). In comparison with VEGF treatment, in which nuclei (NUs), rough endoplasmic reticulum (RER), and regular mitochondria (Ms) were visible, VEGF + B20 (murine AVA) treatment induced numerous autophagosomes (APs), lysosomes (Ly), and autolysosomes (Aly); abundant phagophores (Ph) were identified in Aly membranes. The substructure was observed under 5,000× and 50,000× magnification (n = 5).

Article Snippet: Myc-DDK (Flag)–tagged VEGFR2 (CAT#: RC219851; Origene, Rockville, MD) was stably overexpressed in RF24-par cells.

Techniques: Expressing, Marker, Immunoprecipitation, Transmission Assay, Electron Microscopy, Comparison

(A) Bevacizumab (Bev) induced enrichment of LC3B loci only in AVA-sensitive RF24-par cells, not in resistant RF24-Bev cells. Shown are representative confocal microscopy images for GFP-LC3B (green) expression in RF24-par or RF24-Bev cells in response to treatment with CTL, VEGF only, or VEGF + Bev. Scale bar, 50 μm; n = 3. Red arrows show the LC3B loci formed in the cells. (B) In vitro transfection with the pMAP-LC3B CRISPR-Cas9 construct used to knock out LC3B and insertion of pMAP LC3B homology-directed DNA repair (HDR) in RF24-par endothelial cells (ECs). (C) Expression or absence of LC3B in 3 CRISPR-Cas9 knockout (KO) cells. β-Actin was used as a loading CTL. (D) Representative confocal microscopy images of VEGFR2 (green) in RF24-par WT cells or LC3B2 CRISPR-Cas9 KO cells treated with VEGF + Bev. Scale bar, 50 μm; n = 3. (E–G) Autophagy inhibition by hydroxychloroquine (HCQ) reduced VEGFR2 internalization into the LC3B lysosomal compartment and NU in RF24 cells. RF24-par cells pre-treated with 40μM HCQ (24 h) were subjected to VEGF-A alone or Bev + VEGF-A treatment for another 48 h. (E) LC3B loci in cells were first determined by immunofluorescence staining with an anti-LC3B antibody. Scale bar, 50μm. (F) The autophagy flux in RF24-par cells with or without HCQ treatment was measured by acridine orange (AO) staining and analyzed with fluorescence-activated cell sorting (FACS). The percentage of acidic vesicle organelles (AVOs) was statistically compared between CTL and HCQ or VEGF-A + Bev and HCQ + VEGF-A + Bev; two-tailed Student’s t test. Data are expressed as mean ± SD (n = 3). (G) Representative images of confocal microscopy on RF24-par cells treated with HCQ or left untreated and stained with Hoechst (blue)/VE-cadherin(green)/VEGFR2 (red) for each group (CTL, VEGF, and VEGF + Bev). Each experiment was repeated at least three times, and representative images from 15 high-power fields in each condition are shown. Membrane VEGFR2 and VE-cadherin were present in RF24-par cells pretreated with HCQ + VEGF-A + Bev, where the nuclear VEGFR2 was minimal in comparison with the internalized VEGFR2 in and/or . Scale bar, 50 μm; n = 3.

Journal: Cell reports

Article Title: Endothelial p130cas confers resistance to anti-angiogenesis therapy

doi: 10.1016/j.celrep.2022.110301

Figure Lengend Snippet: (A) Bevacizumab (Bev) induced enrichment of LC3B loci only in AVA-sensitive RF24-par cells, not in resistant RF24-Bev cells. Shown are representative confocal microscopy images for GFP-LC3B (green) expression in RF24-par or RF24-Bev cells in response to treatment with CTL, VEGF only, or VEGF + Bev. Scale bar, 50 μm; n = 3. Red arrows show the LC3B loci formed in the cells. (B) In vitro transfection with the pMAP-LC3B CRISPR-Cas9 construct used to knock out LC3B and insertion of pMAP LC3B homology-directed DNA repair (HDR) in RF24-par endothelial cells (ECs). (C) Expression or absence of LC3B in 3 CRISPR-Cas9 knockout (KO) cells. β-Actin was used as a loading CTL. (D) Representative confocal microscopy images of VEGFR2 (green) in RF24-par WT cells or LC3B2 CRISPR-Cas9 KO cells treated with VEGF + Bev. Scale bar, 50 μm; n = 3. (E–G) Autophagy inhibition by hydroxychloroquine (HCQ) reduced VEGFR2 internalization into the LC3B lysosomal compartment and NU in RF24 cells. RF24-par cells pre-treated with 40μM HCQ (24 h) were subjected to VEGF-A alone or Bev + VEGF-A treatment for another 48 h. (E) LC3B loci in cells were first determined by immunofluorescence staining with an anti-LC3B antibody. Scale bar, 50μm. (F) The autophagy flux in RF24-par cells with or without HCQ treatment was measured by acridine orange (AO) staining and analyzed with fluorescence-activated cell sorting (FACS). The percentage of acidic vesicle organelles (AVOs) was statistically compared between CTL and HCQ or VEGF-A + Bev and HCQ + VEGF-A + Bev; two-tailed Student’s t test. Data are expressed as mean ± SD (n = 3). (G) Representative images of confocal microscopy on RF24-par cells treated with HCQ or left untreated and stained with Hoechst (blue)/VE-cadherin(green)/VEGFR2 (red) for each group (CTL, VEGF, and VEGF + Bev). Each experiment was repeated at least three times, and representative images from 15 high-power fields in each condition are shown. Membrane VEGFR2 and VE-cadherin were present in RF24-par cells pretreated with HCQ + VEGF-A + Bev, where the nuclear VEGFR2 was minimal in comparison with the internalized VEGFR2 in and/or . Scale bar, 50 μm; n = 3.

Article Snippet: Myc-DDK (Flag)–tagged VEGFR2 (CAT#: RC219851; Origene, Rockville, MD) was stably overexpressed in RF24-par cells.

Techniques: Confocal Microscopy, Expressing, In Vitro, Transfection, CRISPR, Construct, Knock-Out, Inhibition, Immunofluorescence, Staining, Fluorescence, FACS, Two Tailed Test, Membrane, Comparison

(A) Nuclear TNKS1BP1 enrichment in RF24-par cells in response to Bev treatment. MOF, membranous fraction. β-Actin was used as Cyto CTL, p-cadherin as MOF CTL, and LMNB1 as NER CTL. (B) Expression of endothelial TNKS1BP1, shown by dual immunofluorescence staining for TNKS1BP1 (red) and CD31 (green), in ovarian tumor samples that were sensitive or resistant to AVA therapy (Bev). (C) Co-immunoprecipitation (coIP) of VEGFR2 and TNKS1BP1 in RF24-par cells under Bev treatment. The anti-VEGFR2 and anti-TNKS1BP1 immunoprecipitates were re-probed with an anti-p130cas antibody. (D) Representative confocal microscopy images showing TNKS1BP1 (green) and VEGFR2 (red) distributed into the NUs of RF24-par cells in response to Bev treatment (VEGF + Bev); this is distinctly different from the expression patterns in cells treated with CTL or VEGF only. Scale bar, 50 μm; n = 3. (E) Knockdown of TNKS1BP1 in RF24-par cells with shRNAs (A–D). (F and G) The graph shows mean numbers of SYTOX — live cells for each treatment group (F; data are expressed as mean ± SD, n = 3, p < 0.001 or not significant [ns], two-tailed Student’s t test. Notably, in cells treated with scramble shRNA, the percentage of SYTOX — viable cells was 36.3% under VEGF + Bev treatment; in cells transfected with shRNA A or C, the percentages of SYTOX — live cells were 72.61% and 84.98%, respectively, under VEGF + Bev treatment. Also shown are representative plots of SYTOX — populations from FACS analysis of RF24-par cells transfected with scramble shRNA, shRNA A, or shRNA C against TNKS1BP1 and treated with CTL, VEGF only, or VEGF + Bev (G). (H) Representative confocal images showing nuclear TNKS1BP1 and VEGFR2 in RF24-par scramble shRNA cells; VEGFR2 remained at the membrane in RF24-par shRNA-TNKS1BP1—A cells under VEGF + Bev treatment. Scale bar, 50 mm; n = 3.

Journal: Cell reports

Article Title: Endothelial p130cas confers resistance to anti-angiogenesis therapy

doi: 10.1016/j.celrep.2022.110301

Figure Lengend Snippet: (A) Nuclear TNKS1BP1 enrichment in RF24-par cells in response to Bev treatment. MOF, membranous fraction. β-Actin was used as Cyto CTL, p-cadherin as MOF CTL, and LMNB1 as NER CTL. (B) Expression of endothelial TNKS1BP1, shown by dual immunofluorescence staining for TNKS1BP1 (red) and CD31 (green), in ovarian tumor samples that were sensitive or resistant to AVA therapy (Bev). (C) Co-immunoprecipitation (coIP) of VEGFR2 and TNKS1BP1 in RF24-par cells under Bev treatment. The anti-VEGFR2 and anti-TNKS1BP1 immunoprecipitates were re-probed with an anti-p130cas antibody. (D) Representative confocal microscopy images showing TNKS1BP1 (green) and VEGFR2 (red) distributed into the NUs of RF24-par cells in response to Bev treatment (VEGF + Bev); this is distinctly different from the expression patterns in cells treated with CTL or VEGF only. Scale bar, 50 μm; n = 3. (E) Knockdown of TNKS1BP1 in RF24-par cells with shRNAs (A–D). (F and G) The graph shows mean numbers of SYTOX — live cells for each treatment group (F; data are expressed as mean ± SD, n = 3, p < 0.001 or not significant [ns], two-tailed Student’s t test. Notably, in cells treated with scramble shRNA, the percentage of SYTOX — viable cells was 36.3% under VEGF + Bev treatment; in cells transfected with shRNA A or C, the percentages of SYTOX — live cells were 72.61% and 84.98%, respectively, under VEGF + Bev treatment. Also shown are representative plots of SYTOX — populations from FACS analysis of RF24-par cells transfected with scramble shRNA, shRNA A, or shRNA C against TNKS1BP1 and treated with CTL, VEGF only, or VEGF + Bev (G). (H) Representative confocal images showing nuclear TNKS1BP1 and VEGFR2 in RF24-par scramble shRNA cells; VEGFR2 remained at the membrane in RF24-par shRNA-TNKS1BP1—A cells under VEGF + Bev treatment. Scale bar, 50 mm; n = 3.

Article Snippet: Myc-DDK (Flag)–tagged VEGFR2 (CAT#: RC219851; Origene, Rockville, MD) was stably overexpressed in RF24-par cells.

Techniques: Expressing, Immunofluorescence, Staining, Immunoprecipitation, Confocal Microscopy, Knockdown, Two Tailed Test, shRNA, Transfection, Membrane

(A) Representative images of immunohistochemical peroxidase staining for p130cas in ECs in normal human ovary or ovarian cancer tissue. Negative CTL represents a sample of ovarian cancer tissue used in the current study, processed for immunohistochemistry with a secondary antibody alone. (B) Kaplan-Meier curves showing disease-specific mortality estimates for individuals with ovarian cancer based on the degree of p130cas expression in the tumor-associated vasculature; p < 0.001, determined by unpaired two-sided Student’s t test. (C) Representative images of dual immunofluorescence staining for p130cas (red) and CD31 (green) in the same sets of human ovary or ovarian cancer samples. (D) Microvessel density (MVD) was calculated by averaging MVD from four random fields per sample. Data are expressed as mean ± SD; p < 0.05, determined by two-sided Student’s t test (n = 3). (E) p130cas expression in normal and tumor-associated ECs from normal human ovary and ovarian tumors was measured by quantitative real-time PCR. Data are expressed as mean ± SD. p < 0.05, determined by two-sided Student’s t test (n = 3). (F) Representative images of dual immunofluorescence staining of LC3B (green) and human VEGFR2 (red) (top panel) or CD31 (green) and human p130cas (red) (bottom panel) in advanced-stage human ovarian cancer samples. Individual A had an omentum tumor and responded to Bev-based therapy, individual B hada right ovary tumor as the primary site and inconclusive response to Bev, and individual C had a right ovary tumor and did not respond to Bev-based therapy. Hoechst staining (blue) was used to shown nuclei. (G) Schematic of internalization of p130cas/VEGFR2 fragments and initiation of EC death through binding with TNKS1BP1 in response to AVA treatment. Left: activated p130cas (phosphorylated) serves as a scaffold protein for activating the downstream FAK-mediated angiogenic processes (focal adhesion turnover, cell survival, and/ or migration/invasion) in ECs when stimulated by VEGF-A. Right: in response to treatment with Bev, membrane-tethered VEGFR2 is cleaved by caspase-10. Together with the ~31-kD p130cas fragment, the VEGFR2 fragment is internalized into LC3B-tagged APs. Next, a complex formed by the VEGFR2 and p130cas fragments and TNKS1BP1 translocates into the nucleus and initiates endothelial cell death, which leads to reduced angiogenesis, followed by inhibition of tumor growth.

Journal: Cell reports

Article Title: Endothelial p130cas confers resistance to anti-angiogenesis therapy

doi: 10.1016/j.celrep.2022.110301

Figure Lengend Snippet: (A) Representative images of immunohistochemical peroxidase staining for p130cas in ECs in normal human ovary or ovarian cancer tissue. Negative CTL represents a sample of ovarian cancer tissue used in the current study, processed for immunohistochemistry with a secondary antibody alone. (B) Kaplan-Meier curves showing disease-specific mortality estimates for individuals with ovarian cancer based on the degree of p130cas expression in the tumor-associated vasculature; p < 0.001, determined by unpaired two-sided Student’s t test. (C) Representative images of dual immunofluorescence staining for p130cas (red) and CD31 (green) in the same sets of human ovary or ovarian cancer samples. (D) Microvessel density (MVD) was calculated by averaging MVD from four random fields per sample. Data are expressed as mean ± SD; p < 0.05, determined by two-sided Student’s t test (n = 3). (E) p130cas expression in normal and tumor-associated ECs from normal human ovary and ovarian tumors was measured by quantitative real-time PCR. Data are expressed as mean ± SD. p < 0.05, determined by two-sided Student’s t test (n = 3). (F) Representative images of dual immunofluorescence staining of LC3B (green) and human VEGFR2 (red) (top panel) or CD31 (green) and human p130cas (red) (bottom panel) in advanced-stage human ovarian cancer samples. Individual A had an omentum tumor and responded to Bev-based therapy, individual B hada right ovary tumor as the primary site and inconclusive response to Bev, and individual C had a right ovary tumor and did not respond to Bev-based therapy. Hoechst staining (blue) was used to shown nuclei. (G) Schematic of internalization of p130cas/VEGFR2 fragments and initiation of EC death through binding with TNKS1BP1 in response to AVA treatment. Left: activated p130cas (phosphorylated) serves as a scaffold protein for activating the downstream FAK-mediated angiogenic processes (focal adhesion turnover, cell survival, and/ or migration/invasion) in ECs when stimulated by VEGF-A. Right: in response to treatment with Bev, membrane-tethered VEGFR2 is cleaved by caspase-10. Together with the ~31-kD p130cas fragment, the VEGFR2 fragment is internalized into LC3B-tagged APs. Next, a complex formed by the VEGFR2 and p130cas fragments and TNKS1BP1 translocates into the nucleus and initiates endothelial cell death, which leads to reduced angiogenesis, followed by inhibition of tumor growth.

Article Snippet: Myc-DDK (Flag)–tagged VEGFR2 (CAT#: RC219851; Origene, Rockville, MD) was stably overexpressed in RF24-par cells.

Techniques: Immunohistochemical staining, Staining, Immunohistochemistry, Expressing, Immunofluorescence, Real-time Polymerase Chain Reaction, Binding Assay, Migration, Membrane, Inhibition

Panel A: HEK293 cells transfected with VEGFR2 and conditioned media immunoblotted for sFlt1. VEGFR2 expression dose dependently increases sFlt1 expression. Panel B: HEK293 cells transfected with VEGFR2 and VEGF in conditioned media measured by ELISA. VEGFR2 dose dependently reduces free VEGF in conditioned media. **p<0.001 against vehicle, $ p<0.05 between low and high VEGFR2 expressed groups, n = 4. Panel C: HEK293 cells co-transfected with epitope tagged Flt1 ΔCTD and VEGFR2 and Flt1 ΔCTD (Flag epitope) and its N-term fragment (HA epitope) measured in cell lysates and conditioned media respectively. Cell lysates were also immunoblotted for VEGFR2 to confirm overexpression and for tubulin as a control for loading. VEGFR2 dose dependently reduces cleavage of Flt1 manifest by increased abundance of uncleaved Flt1 in cell lysates and reduced abundance of the cleaved N-terminal fragment in conditioned media (condt. Media). Panel D: HEK293 cells co-transfected with epitope tagged Flt1 ΔCTD and VEGFR2 or control plasmid and treated with 30 nM PMA in the presence and absence of 10 U/ml heparin overnight. Conditioned media (Condt. Media) was immunoblotted for the N-terminal fragment while cell lysates were immunoprecipitated with Flag and then blotted for VEGFR2 (Flk1). VEGFR2 significantly reduces the availability of the cleaved Flt1 fragment in conditioned media while heparin has a modest effect. VEGFR2 and Flt1 physically associate and heparin does not alter this association.

Journal: PLoS ONE

Article Title: N-Terminal Cleavage and Release of the Ectodomain of Flt1 Is Mediated via ADAM10 and ADAM 17 and Regulated by VEGFR2 and the Flt1 Intracellular Domain

doi: 10.1371/journal.pone.0112794

Figure Lengend Snippet: Panel A: HEK293 cells transfected with VEGFR2 and conditioned media immunoblotted for sFlt1. VEGFR2 expression dose dependently increases sFlt1 expression. Panel B: HEK293 cells transfected with VEGFR2 and VEGF in conditioned media measured by ELISA. VEGFR2 dose dependently reduces free VEGF in conditioned media. **p<0.001 against vehicle, $ p<0.05 between low and high VEGFR2 expressed groups, n = 4. Panel C: HEK293 cells co-transfected with epitope tagged Flt1 ΔCTD and VEGFR2 and Flt1 ΔCTD (Flag epitope) and its N-term fragment (HA epitope) measured in cell lysates and conditioned media respectively. Cell lysates were also immunoblotted for VEGFR2 to confirm overexpression and for tubulin as a control for loading. VEGFR2 dose dependently reduces cleavage of Flt1 manifest by increased abundance of uncleaved Flt1 in cell lysates and reduced abundance of the cleaved N-terminal fragment in conditioned media (condt. Media). Panel D: HEK293 cells co-transfected with epitope tagged Flt1 ΔCTD and VEGFR2 or control plasmid and treated with 30 nM PMA in the presence and absence of 10 U/ml heparin overnight. Conditioned media (Condt. Media) was immunoblotted for the N-terminal fragment while cell lysates were immunoprecipitated with Flag and then blotted for VEGFR2 (Flk1). VEGFR2 significantly reduces the availability of the cleaved Flt1 fragment in conditioned media while heparin has a modest effect. VEGFR2 and Flt1 physically associate and heparin does not alter this association.

Article Snippet: C-terminal GFP-tagged open reading frame (ORF) clone of full length human VEGFR2 was purchased from OriGene (Rockville, MD).

Techniques: Transfection, Expressing, Enzyme-linked Immunosorbent Assay, FLAG-tag, Over Expression, Control, Plasmid Preparation, Immunoprecipitation